Journal: bioRxiv

Article Title: DNA repair and anti-cancer mechanisms in the longest-living mammal: the bowhead whale

doi: 10.1101/2023.05.07.539748

Figure Lengend Snippet: a , Images of representative fibroblast colonies for tested cell lines after 4 weeks of growth in soft agar. The top panel indicates whether the cell lines in the column below have the indicated protein overexpressed (+), inactivated (-), or expressed in the active endogenous form (WT). Text above individual images indicate for that cell line whether tumor suppressors are inactivated through genetic knockout or SV40 Large T (or LT mutants) or Small T (ST) antigen. Icons in corners of images indicate species. Scale bar is 250 µm. b , Volumetric growth curves for the indicated bowhead whale fibroblast cell lines in mouse xenograft assays. All cell lines shown stably express H-Ras G12V and hTERT in addition to the genotype indicated in the figure legend. Data points represent averages from 3 immunodeficient nude mice injected bilaterally (6 injections) for each cell line, except for TP53 -/- RB1 -/- double knockouts, for which 2 independent cell lines were tested, for a total of 6 mice/12 injections. Experiments were terminated based on endpoints for maximum tumor size or duration of experiment as described in Methods. Images in the legend show a representative mouse for the indicated cell line at the final measured time point. Error bars show SEM. c , Western blot for p53 protein in clonally isolated fibroblast colonies following CRISPR targeting of TP53 . Underlined lanes indicate colonies selected for further validation and experiments. d , Western blot for Rb protein in fibroblast clones following CRISPR targeting of RB1 on an p53 knockout background.

Article Snippet: For p53 activity measurement, 1 x 10 cells of control (WT) and clonally isolated p53 KO cell lines were electroporated with 3 µg p53 firefly luciferase reporter plasmid pp53-TA-Luc (Clontech/Takara) and 0.3 ug renilla luciferase control plasmid pRL-CMV (Promega) on an Amaxa Nucleofector 2b (Lonza).

Techniques: Knock-Out, Stable Transfection, Injection, Western Blot, Isolation, CRISPR, Clone Assay

Journal: bioRxiv

Article Title: DNA repair and anti-cancer mechanisms in the longest-living mammal: the bowhead whale

doi: 10.1101/2023.05.07.539748

Figure Lengend Snippet: a , Western blot for p53 protein in fibroblasts clones following CRISPR targeting of TP53 . Labeled clones were for further validation and experiments. b , Western blot for Rb protein in fibroblast clones following CRISPR targeting of RB1 on p53 knockout background. c , Ratio of firefly:renilla luciferase luminescence in fibroblasts transfected with firefly luciferase reporter of p53 transcriptional activity and renilla luciferase control. Cells were treated with etoposide to induce p53 activity. d , Ratio of firefly:renilla luciferase luminescence in fibroblasts transfected with firefly luciferase reporter of E2F transcriptional activity and renilla luciferase control. Transfected cells were serum starved for 24h and returned to complete medium for 24h before luminescence measurement. Higher E2F activity results from reduced Rb activity. Error bars represent SD. ****p<0.001 (two-tailed t test), n=3.

Article Snippet: For p53 activity measurement, 1 x 10 cells of control (WT) and clonally isolated p53 KO cell lines were electroporated with 3 µg p53 firefly luciferase reporter plasmid pp53-TA-Luc (Clontech/Takara) and 0.3 ug renilla luciferase control plasmid pRL-CMV (Promega) on an Amaxa Nucleofector 2b (Lonza).

Techniques: Western Blot, Clone Assay, CRISPR, Labeling, Knock-Out, Luciferase, Transfection, Activity Assay, Two Tailed Test

Journal: Advanced Science

Article Title: FGF12 Positively Regulates Keratinocyte Proliferation by Stabilizing MDM2 and Inhibiting p53 Activity in Psoriasis

doi: 10.1002/advs.202400107

Figure Lengend Snippet: FGF12 promotes proliferation and cell cycle transition of keratinocytes through p53 signaling. A–C) KEGG analysis for the significantly upregulated signaling by the interference of si‐Scr or si‐ Fgf12 in HaCaT cells treated by M5 for 12 h. The Top 15 upregulated GO signal pathways were listed. D) GSEA showing the significant enrichment of p53 signaling in M5 treated HaCaT cells under FGF12 interference. E) Immunoblotting and quantitative analysis of p53 and p21 protein levels in NHEK cells that were treated with si‐Scr or si‐ Fgf12 and stimulated with M5 for 12 h. β‐Actin was used as a loading control (n = 4). F) Immunoblotting and quantitative analysis of p53 and p21 levels in Krt14 +/+ ‐Fgf12 f/f and Krt14 Cre/+ ‐Fgf12 f/f mice were treated with IMQ. β‐Actin was used as a loading control (n = 6). Error bars show the mean ± SEM. **p < 0.01; ***p < 0.001. The p value was determined using two‐tailed unpaired Student's t test (E and F). All numbers (n) are biologically independent experiments.

Article Snippet: Cells were transfected with p53 luciferase reporter (pP53‐TA‐luc, D2223, Beyotime) and Renilla luciferase reporter (pRL‐TK; Promega, Madison, WI, USA) and using Lipofectamine 3000 (Invitrogen, L3000‐001).

Techniques: Western Blot, Control, Two Tailed Test

Journal: Advanced Science

Article Title: FGF12 Positively Regulates Keratinocyte Proliferation by Stabilizing MDM2 and Inhibiting p53 Activity in Psoriasis

doi: 10.1002/advs.202400107

Figure Lengend Snippet: FGF12 deficiency‐driven amelioration of keratinocyte proliferation is p53 dependent. A) Immunoblotting and quantitative analysis of p53 protein level in NHEK cells that were transfected in si‐Scr or si‐ p53 . β‐Actin was used as a loading control (n = 5). B) Immunoblotting and quantitative analysis of Cyclin A1, Cyclin D1, and Cyclin E1 protein levels in NHEK cells that si‐ p53 or si‐Scr was transfected in FGF12‐interference cells treated with M5 for 12 h. β‐Actin was used as a loading control (n = 4). C) Flow cytometric plots of cell‐cycle analysis performed with PI staining on HaCaT cells that si‐ p53 or si‐Scr was transfected in FGF12‐interference cells treated with M5 for 12 h (left). Quantification the percentage of cells that fall into the sub G0/G1, S, or G2/M gates (right) (n = 5). D) Immunofluorescent and quantitative analysis (bottom) of Ki‐67 + in NHEK cells that si‐ p53 or si‐Scr was transfected in FGF12‐interference cells treated with M5 for 12 h. Nuclei were stained with DAPI (blue) (n = 5). Scale bar = 50 µm. E) Immunofluorescent and quantitative analysis (bottom) of EdU + in HaCaT cells that si‐ p53 or si‐Scr was transfected in FGF12‐interference cells treated with M5 for 12 h. Nuclei were stained with Hoechst (blue) (n = 5). Scale bar = 50 µm. Error bars show the mean ± SEM. *p < 0.05; **p < 0.01; ***p < 0.001. & p < 0.05; && p < 0.01; &&& p < 0.001. The p value was determined using two‐tailed unpaired Student's t test (A) or one‐way ANOVA (B‐E). All numbers (n) are biologically independent experiments.

Article Snippet: Cells were transfected with p53 luciferase reporter (pP53‐TA‐luc, D2223, Beyotime) and Renilla luciferase reporter (pRL‐TK; Promega, Madison, WI, USA) and using Lipofectamine 3000 (Invitrogen, L3000‐001).

Techniques: Western Blot, Transfection, Control, Cell Cycle Assay, Staining, Two Tailed Test

Journal: Advanced Science

Article Title: FGF12 Positively Regulates Keratinocyte Proliferation by Stabilizing MDM2 and Inhibiting p53 Activity in Psoriasis

doi: 10.1002/advs.202400107

Figure Lengend Snippet: FGF12 represses expression of p53 through MDM2. A) Immunoblotting and quantitative analysis of p53 and p21 protein levels in NHEK cells that si‐ MDM2 or si‐Scr was transfected in Flag‐ Fgf12 cells treated with M5. β‐Actin was used as a loading control (n = 4). B) Immunofluorescent and quantitative analysis (down) of p53 in HaCaT cells that si‐ MDM2 or si‐Scr was transfected in Flag‐ Fgf12 cells treated with M5. Nuclei were stained with DAPI (blue) (n = 5). Scale bar = 50 µm. C) qRT‐PCR analysis for p53 and p21 mRNA levels in HaCaT cells that si‐ MDM2 or si‐Scr was transfected in Flag‐ Fgf12 cells treated with M5 for 12 h (n = 5). D) p53‐dependent transcriptional activity of p53 determined by performing dual‐luciferase assays with HEK293 cells overexpressing FGF12 in the presence of si‐Scr, or si‐ MDM2 (n = 5). E) Immunoblotting and quantitative analysis of Cyclin A1, Cyclin D1, and Cyclin E1 protein levels in NHEK cells that Vector or His‐ MDM2 was transfected in FGF12‐interference cells treated with M5 for 12 h. β‐Actin was used as a loading control (n = 4). F) Immunofluorescent and quantitative analysis of Ki‐67 + in NHEK cells that Vector or His‐ MDM2 was transfected in FGF12‐interference cells treated with M5 for 12 h. Nuclei were stained with DAPI (blue) (n = 5). Scale bar = 50 µm. Error bars show the mean ± SEM. **p < 0.01; ***p < 0.001. & p < 0.05; && p < 0.01. The p value was determined using one‐way ANOVA (A‐F). All numbers (n) are biologically independent experiments.

Article Snippet: Cells were transfected with p53 luciferase reporter (pP53‐TA‐luc, D2223, Beyotime) and Renilla luciferase reporter (pRL‐TK; Promega, Madison, WI, USA) and using Lipofectamine 3000 (Invitrogen, L3000‐001).

Techniques: Expressing, Western Blot, Transfection, Control, Staining, Quantitative RT-PCR, Activity Assay, Luciferase, Plasmid Preparation

Journal: Advanced Science

Article Title: FGF12 Positively Regulates Keratinocyte Proliferation by Stabilizing MDM2 and Inhibiting p53 Activity in Psoriasis

doi: 10.1002/advs.202400107

Figure Lengend Snippet: Loss of p53 abolishes the mitigatory effects of FGF12 knockdown on psoriasis in mice. A) Immunofluorescence images for the skin of mice with knock‐down respective genes were labeled with the indicated antibodies. Nuclei were stained with DAPI (blue). Scar bar = 50 µm. B) Immunoblotting and quantitative analysis of p53 protein level in AAV‐ GFP and AAV‐sh‐ p53 mice. β‐Actin was used as a loading control (n = 5). C) Representative histological sections of the dorsal back from Krt14 +/+ ‐Fgf12 f/f ; AAV‐ GFP , Krt14 Cre/+ ‐Fgf12 f/f ; AAV‐ GFP and Krt14 Cre/+ ‐Fgf12 f/f ; AAV‐sh‐ p53 mice treated by IMQ stained with H&E, and quantification of the epidermal thickness and the infiltrating cells (n = 5). Scale bars = 100 µm. D) Immunofluorescent and quantitative analysis of K6 in the skin from Krt14 +/+ ‐Fgf12 f/f ; AAV‐ GFP , Krt14 Cre/+ ‐Fgf12 f/f ; AAV‐ GFP and Krt14 Cre/+ ‐Fgf12 f/f ; AAV‐sh‐ p53 mice induced by IMQ. Nuclei were stained with DAPI (blue) (n = 5). Scale bars = 50 µm. E) Immunofluorescent and quantitative analysis of Ki‐67 positive cells in the skin from Krt14 +/+ ‐Fgf12 f/f ; AAV‐ GFP , Krt14 Cre/+ ‐Fgf12 f/f ; AAV‐ GFP and Krt14 Cre/+ ‐Fgf12 f/f ; AAV‐sh‐ p53 mice stimulated by IMQ. Nuclei were stained with DAPI (blue) (n = 5). Scale bars = 100 µm. F) Immunoblotting of Cyclin A1, Cyclin D1, and Cyclin E1 protein levels in the skin from Krt14 +/+ ‐Fgf12 f/f ; AAV‐ GFP , Krt14 Cre/+ ‐Fgf12 f/f ; AAV‐ GFP and Krt14 Cre/+ ‐Fgf12 f/f ; AAV‐sh‐ p53 mice treated by IMQ. β‐Actin was used as a loading control (n = 6). Error bars show the mean ± SEM. *p < 0.05; **p < 0.01; ***p < 0.001. & p < 0.05; && p < 0.01; &&& p < 0.001. The p value was determined using two‐tailed unpaired Student's t test (B) or one‐way ANOVA (C‐F). All numbers (n) are biologically independent experiments.

Article Snippet: Cells were transfected with p53 luciferase reporter (pP53‐TA‐luc, D2223, Beyotime) and Renilla luciferase reporter (pRL‐TK; Promega, Madison, WI, USA) and using Lipofectamine 3000 (Invitrogen, L3000‐001).

Techniques: Knockdown, Immunofluorescence, Labeling, Staining, Western Blot, Control, Two Tailed Test

Journal: Cellular and Molecular Life Sciences

Article Title: Loss of fragile WWOX gene leads to senescence escape and genome instability

doi: 10.1007/s00018-023-04950-1

Figure Lengend Snippet: p53 inactivation causes the failure of senescence induction in Wwox −/− MEFs. a The upper panel is the schematic diagram of p53 protein. The amino acid sequence alignment of human and mouse p53 DBD is shown in the lower panel. TAD, transactivation domain; PRD, proline-rich domain; DBD, DNA-binding domain; TD, tetramerization domain; CRD, C-terminal regulatory domain. b , c The sequencing results of p53 gene coding region from Wwox +/− (clone no. 54) and Wwox −/− (clone no. 56) MEFs at passages 1 (early), 8 (intermediate) and 20 (late) are shown. In b , the nucleotide 638 from the translational start site of murine p53 changed from thymine to guanine, leading to a substitution of valine to glycine at position 213 in the intermediate and late-passage Wwox −/− MEF clone no. 56. In c , the change of nucleotide 403 from guanine to cytosine resulted in a substitution of alanine to proline in p53 in the late-passage Wwox −/− MEF clone no. 56. d Subcellular protein fractionation and western blotting were performed to examine the nuclear and cytosolic expression of p53 and p21 Cip1/Waf1 in late-passage Wwox +/− and Wwox −/− MEFs (clone no. 54 and 56, respectively). Histone H3 and GAPDH were used as nuclear and cytosolic protein controls, respectively. e ChIP assay was conducted using the chromatin isolated from late-passage Wwox +/− and Wwox −/− MEFs (clone no. 54 and 56, respectively). The immunoprecipitated chromatin using a control or anti-p53 antibody was analyzed for the presence of p21 Cip1/Waf1 promoter sequence (from − 200 to 98) by real-time PCR using the specific primers shown in Supplementary Table 1. The quantitative results of ChIP assay were normalized by the input control groups. Data are presented as mean ± SD from three independent experiments. *** P ≤ 0.005; Two-tailed paired t test. f A reporter construct containing a p53-driven promoter sequence (pp53-TA-Luc) was transfected into MEFs. The thymidine kinase promoter-Renilla luciferase reporter plasmid (pRL-TK) was used as an internal control. Luciferase activities were determined at 16 h after transfection. Data are presented as mean ± SD from three independent experiments. *** P ≤ 0.005; Two-tailed t test. g The protein expression of endogenous p21 Cip1/Waf1 (black arrow), p53 and WWOX and ectopic GFP-tagged human p53 (GFP-p53; black arrowhead) in late-passage Wwox +/+ , Wwox +/− , Wwox −/− MEFs (clone no. 32-5, 54 and 56, respectively) was examined by western blotting. β-actin was used as an internal control. M.W., molecular weight. h Cell growth rates of late-passage Wwox +/+ , Wwox +/− , Wwox −/− (clone no. 32-5, 54 and 56, respectively) and Wwox −/− MEFs expressing ectopic GFP-p53 or GFP protein. N.S. not significant; *** P ≤ 0.005; Two-tailed t test. i SA-β-gal staining of late-passage Wwox +/+ , Wwox +/− , Wwox −/− (clone no. 32-5, 54 and 56, respectively) and Wwox −/− MEFs expressing ectopic GFP-p53 protein. The lower panel pictures are the magnified images from the blue boxed areas in the upper panel. The percentages of SA-β-gal-positive senescent cells (red arrowheads) are shown at the right panel. Scale bars = 100 µm. * P ≤ 0.05; *** P ≤ 0.005; Two-tailed t test

Article Snippet: The pp53-TA-Luc luciferase-based reporter plasmid harboring a p53 response element (#PT3511-5W; Clontech, Mountain View, CA, USA) was used for monitoring p53-mediated signaling in MEFs.

Techniques: Sequencing, Binding Assay, Fractionation, Western Blot, Expressing, Isolation, Immunoprecipitation, Real-time Polymerase Chain Reaction, Two Tailed Test, Construct, Transfection, Luciferase, Plasmid Preparation, Molecular Weight, Staining

Journal: International Journal of Molecular Sciences

Article Title: The Males Absent on the First (MOF) Mediated Acetylation Alters the Protein Stability and Transcriptional Activity of YY1 in HCT116 Cells

doi: 10.3390/ijms24108719

Figure Lengend Snippet: The YY1/146–270 region and the YY1K183 site play important roles in p53RE-mediated downstream target gene transactivation in HCT116 cells. ( A ) The schematic diagram of target genes up- or down-regulated by YY1. ( B ) The schematic diagram of a p53RE-Luc plasmid. Multiple response elements of TP53 were inserted into the pp53-TA-Luc vector. ( C , D ) The effects of YY1 and its truncated mutants on p53RE-Luc luciferase activity and related protein levels. * p < 0.05 or # p < 0.05, compared to the p53RT-Luc group. ( E ) P53 and its downstream protein levels in YY1 knockdown HCT116 cells. ( F ) Effects of YY1 and its point mutants on p21 protein levels. Increasing amounts of YY1wt, YY1K183R, and YY1K258R were transfected into HCT116 cells, and p21 protein levels were analyzed by a Western blot using the anti-p21 antibody. ( G ) The effects of YY1 and MOF on p53RE-Luc luciferase activity. * p < 0.05 or ** p < 0.01 compared to the p53RT-Luc group; ## p < 0.01 or ### p < 0.001 compared to the p53RT-Luc+MOF groups.

Article Snippet: Pp53-TA-Luc plasmid (D2223, Beyotime), including multiple p53 response elements (ACGTTTGCCTTGCCTGGACTTGCCTGGCCTTGCCTTGGACATGCCCGGGCTGTC), was obtained from Beyotime Biotechnology (Shanghai, China).

Techniques: Plasmid Preparation, Luciferase, Activity Assay, Transfection, Western Blot

Journal: Frontiers in Pharmacology

Article Title: Morroniside attenuates nucleus pulposus cell senescence to alleviate intervertebral disc degeneration via inhibiting ROS-Hippo-p53 pathway

doi: 10.3389/fphar.2022.942435

Figure Lengend Snippet: MR inhibits H 2 O 2 -induced cell senescence of rNP cells. rNP cells were pretreated with indicated concentrations (200 and 400 μM) of MR for 2 h and then treated with 200 μM H 2 O 2 for another 2 h. (A) SA-β-gal staining results showed that MR treatment resulted in a reduction of SA-β-gal-positive cells in rNP cells induced by H 2 O 2 . (B) qPCR assay results showed that the expression of p53 and p21 mRNA induced by H 2 O 2 was significantly decreased in MR-treated rNP cells. (C) Western blot results showed that MR supplementation reversed the enhanced expression of p53 and p21 proteins in H 2 O 2 -induced rNP cells. (D) rNP cells were transiently transfected with a pp53-TA-luc-CP reporter plasmid and cultured with or without H 2 O 2 (200 μM) or MR (200 μM). Total cell lysates were subjected to luciferase assay. Data are expressed as the mean ± SD. **p < 0.01 compared with Control group; #p < 0.05, ##p < 0.01 compared to H 2 O 2 -treated group.

Article Snippet: To examine the transcriptional activity of p53 protein, rNP cells were seeded in 24-well culture plates and transfected with 500 ng pp53-TA-luc-CP (Beyotime) and 20 ng pRL-null expressing Renilla luciferase (Promega, Madison, WI) using X-treme GENE HP DNA Transfection Reagent (Roche, Germany) for 24 h. Then, cells were treated with MR (200 μM), Yap/Taz inhibitor-1 (1 μM) as described in , for another 24 h. Cell lysates were prepared in lysis buffer, and supernatants were used for dual-luciferase assay according to the manufacturer’s instructions (Promega).

Techniques: Staining, Expressing, Western Blot, Transfection, Plasmid Preparation, Cell Culture, Luciferase, Control

Journal: Frontiers in Pharmacology

Article Title: Morroniside attenuates nucleus pulposus cell senescence to alleviate intervertebral disc degeneration via inhibiting ROS-Hippo-p53 pathway

doi: 10.3389/fphar.2022.942435

Figure Lengend Snippet: Hippo signaling participates in MR-mediated protection against H 2 O 2 -induced NP cell senescence. rNP cells were pretreated with the indicated concentration of MR (200 μM) for 2 h, followed by 200 μM H 2 O 2 for another 2 h. (A) Western blot analysis results. (B,C) SA-β-gal staining analysis. rNP cells were pretreated with 1 μM Yap/Taz inhibitor-1 (YTI) and 200 μM MR for 2 h and then treated with 200 μM H 2 O 2 for 2 h. (D) qPCR assay was applied to detect the expression of p53 and p21 mRNA levels in rNP cells. (E) Western blot results of p53 protein expression in response to 1 μM YTI treatment. (F) p53 luciferase reporter gene activity results. rNP cells were transiently transfected with a pp53-TA-luc-CP reporter plasmid and cultured with or without H 2 O 2 (200 μM) or MR (200 μM) or 1 μM YTI for 48 h. Total cell lysates were subjected to luciferase assay. (G) Western blot results of p53 and p21 protein expressions in response to 200 μM MR with siRNA-mediated knockdown of Taz or Yap. rNP cells were treated with or without H 2 O 2 and MR (200 μM) after 24 h of siRNA transfection. Data are representative of 3 independent repeat experiments. Values are expressed as mean ± SD. *p < 0.05, **p < 0.01 compared with control group. #p < 0.05, ##p < 0.01 compared with H 2 O 2 -treated cells. &p < 0.05, &&p < 0.01 compared with MR- and H 2 O 2 -treated cells.

Article Snippet: To examine the transcriptional activity of p53 protein, rNP cells were seeded in 24-well culture plates and transfected with 500 ng pp53-TA-luc-CP (Beyotime) and 20 ng pRL-null expressing Renilla luciferase (Promega, Madison, WI) using X-treme GENE HP DNA Transfection Reagent (Roche, Germany) for 24 h. Then, cells were treated with MR (200 μM), Yap/Taz inhibitor-1 (1 μM) as described in , for another 24 h. Cell lysates were prepared in lysis buffer, and supernatants were used for dual-luciferase assay according to the manufacturer’s instructions (Promega).

Techniques: Concentration Assay, Western Blot, Staining, Expressing, Luciferase, Activity Assay, Transfection, Plasmid Preparation, Cell Culture, Knockdown, Control